pUC/M13 Sequencing Primers

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors. The primers are purified by gel electrophoresis or HPLC.

Primer Sequences

• Forward (17mer): 5´-d(GTTTTCCCAGTCACGAC)-3´
• Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
• Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
• Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Expand to Read More »

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors. The primers are purified by gel electrophoresis or HPLC.

Primer Sequences

• Forward (17mer): 5´-d(GTTTTCCCAGTCACGAC)-3´
• Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
• Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
• Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

References

1. Messing, J. (1983) Meth. Enzymol. 101, 20–78.

« Collapse Content